Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

public class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        List<String> list = new ArrayList<String>();
        Set<String> temp = new HashSet<String>();
        if (s == null || s.length() <= 10)
            return list;
        Set<String> set = new HashSet<String>();
        for (int i = 10; i <= s.length(); i++) {
            if (set.contains(s.substring(i - 10, i))) {
                temp.add(s.substring(i - 10, i));
            } else {
                set.add(s.substring(i - 10, i));
            }
        }
        return new ArrayList<String>(temp);
    }
}